A 1,468 bp DNA fragment corresponding to the downstream region of ohrR was amplified using the primers (AGCTCTAGAGCACCTGCAG; introduces an XbaI restriction site in place of ohrR stop codon) and (CAGCGCGTGTGGCGGCG). This amplicon was digested with XbaI and NsiI (genuine site) and cloned into pK18mobsacB vector [51] between the XbaI and PstI sites, giving pD3001. pD3083 and pD3001

were linearised with XbaI and ligated in click here order to assemble ohrR-upstream and -downstream sequences. Then pGEMTeasy vector was deleted through an EcoRI digest, giving pD4116, and the GmR cassette of p34SGm [52] was inserted into the XbaI site, giving pD4244. This final construction carries the ohr-ohrR region where the ohrR open reading frame is replaced by a GmR cassette; it was GS-4997 price introduced into S. meliloti Rm1021 strain by triparental mating and recombinants were selected for on MSY medium containing gentamycin and sucrose. Double crossing over recombinants were identified as neomycin sensitive strains and confirmed by PCR. The mutation

was transduced into S. meliloti Rm1021 strain using ΦM12 [53], yielding R6.48. Inactivation of ohr A 4 kb chromosomal DNA fragment containing ohr and ohrR genes was amplified by PCR using the primers (GATCGGCCTCGACCCATACG) and (CAGCGCGTGTGGCGGCG) and cloned into pGEMTeasy vector. The insert was recovered with EcoRI and transferred to the same site on pK18mobsacB vector. The Flavopiridol (Alvocidib) ohr open reading frame was then inactivated Dasatinib nmr by introducing into the unique NotI site the GmR cassette from pBBR1-MCS5 digested with NotI. The resulting plasmid pD8657 was introduced into Rm1021 strain and double crossing events were selected as before and confirmed by PCR. The mutation was transduced into Rm1021 strain using ΦM12, yielding R8.39. Construction of an ohr::GmR , ΔohrR strain pD4116 carries the entire

ohr sequence and a deletion of ohrR. The ohr gene was disrupted by introducing in its unique NotI site the GmR resistance cassette from pBBR1-MCS5 recovered through a NotI digest. The resulting pD5333was conjugated into Rm1021 strain and double crossing overs were selected as previously described and confirmed by PCR. Transduction of the mutations into Rm1021strain yielded R7.15. Construction of ohr::lacZ, ohrR::uidA into a wild type genetic background The 4 kb chromosomal fragment amplified for ohr inactivation contains two SalI sites near the 3′end of ohr and ohrR genes respectively. It was cleaved with SalI and the 980 bp DNA fragment containing the 5′ regions of ohr and ohrR was introduced into the XhoI site of pTH1705 vector (not replicative in S. meliloti) [54]. In the resulting pD5455 plasmid two transcriptional fusions are generated: ohr::lacZ and ohrR::uidA. pD5455 was introduced into Rm1021 strain by triparental mating.