Double immunofluorescence combined NCAM and LGR5. NCAM monoclonal antibody (described above) was incubated overnight at 4°C as first antibodies. After washing the sections five times for 5 min, LGR5 monoclonal antibody (described above) was incubated for 2 h at room temperature as the second primary antibody. After washing the sections three times for 5 min, Alexa Fluor* 488 goat antirabbit IgG (A11008; Invitrogen,

Renfrew, UK) and Alexa Fluor* 546 goat antimouse (H + L) IgG (A11030; Invitrogen) as secondary antibodies, at a dilution of 10 µg/mL, were incubated for 1 h at room temperature. Nuclear staining was done with 4′,6′-diamidino-2-phenylindole dihydrochloride (DAPI) (ProLong Gold Antifade Reagent with DAPI; Invitrogen). Confocal images were acquired by IX71 inverted microscopy with a DP70 digital camera system (Olympus, Center Valley, PA, USA). We selected four FFPE specimens with pathological complete response after chemotherapy. Microdissection of FFPE specimens was performed as previously described.12 We separately obtained each specimen from three locations in damaged liver: (i) central necrotic area;

(ii) adjacent normal liver; and (iii) the fibrotic area including DR between the central necrosis and adjacent normal liver. Microdissected specimens were digested with proteinase K in lysis buffer containing Tris-HCl, ethylenediamine tetraacetic acid and sodium dodecylsulfate, as previously published with minor modifications.13 RNA was purified by phenol and chloroform extraction. Isolated RNA was purified using ethanol precipitation. The concentration and quality of RNA was measured Obeticholic Acid price with ultraviolet absorbance at 260 nm and 280 nm (A260/280 ratio). Reverse transcription of fragmented mRNA from FFPE tissues was performed using random hexamer priming, instead of oligo (dT)-based priming. cDNA was synthesized with random

hexamer and Superscript III reverse transcriptase (Invitrogen, Carlsbad, CA, USA) according to the manufacturer’s instructions. Quantitative reverse transcription polymerase chain reaction (RT–PCR) analysis was carried out with SYBR Green PCR Master Mix (Applied Biosystems, Foster City, CA) using the Applied Biosystems 7500 Real-Time PCR System according to the manufacturer’s instructions. Sequences were as follows: KRT7 (CK7) (sense, AGTATGAGGAGATGGCCAAATG; antisense, CCCGGTTCATCTCTGAAATC); NCAM (sense, TGAGTGGAGAGCAGTTGGTG; antisense, TACGTTGTTTCGGGCTTCAG); PROM1 (CD133) (sense, GCTTTGCAATCTCCCTGTTG; antisense, TTGATCCGGGTTCTTACCTG); LGR5 (sense, GATGTTGCTCAGGGTGGACT; antisense, GGGAGCAGCTGACTGATGTT); GAPDH (sense, GGAAGGTGAAGGTCGGAGTC; antisense, AATGAAGGGGTCATTCATGG); and ACTB (β-actin) (sense, HM781-36B order ACAGAGCCTCGCCTTTGC; antisense, GCGGCGATATCATCATCC). Primers for these genes and the internal control (GAPDH and ACTB) were designed with Primer3 software (Biology Workbench ver. 3.2; San Diego Supercomputer Center, University of California, San Diego).