Drug absorption may be affected by advanced HIV disease. Rifamycin-based

TB regimens should be used whenever possible. Coadministration guidance for first-line antiretrovirals is given below. There are few long-term clinical outcome data to support use of these TB/HIV drug combinations. There are no major interactions between rifampicin or rifabutin and lamivudine, emtricitabine, tenofovir, abacavir, check details zidovudine or didanosine. Stavudine should not be given because of the increased risk of peripheral neuropathy with concomitant TB therapy. The preferred regimen for patients who have no contraindication is: Rifampicin+efavirenz Use efavirenz 800 mg/day in patients weighing >60 kg and standard dose 600 mg/day in patients weighing <60 kg   If side effects occur, efavirenz therapeutic drug monitoring (TDM) may be useful Other regimens include Rifampicin+nevirapine* Not recommended but if given then use standard doses and Ganetespib clinical trial perform nevirapine TDM Rifabutin+efavirenz Increase rifabutin to 450 mg daily Rifabutin+nevirapine* Not recommended but if given then use standard doses Rifampicin+unboosted PI Do not use

Rifampicin+boosted PI Not recommended because of poor pharmacokinetics and high rates of hepatotoxicity seen in healthy volunteers Rifabutin+unboosted PI Reduce rifabutin to 150 mg daily; increase unboosted PI Rifabutin+boosted PI Reduce rifabutin to 150 mg three times per week Rifampicin+elvitegravir Do not use Rifampicin+raltegravir* Studies ongoing; use with caution double-dose raltegravir Rifabutin+elvitegravir No data; not recommended Rifabutin+raltegravir Normal doses of both drugs Rifampicin+maraviroc* Not recommended,

but if given use double-dose maraviroc Rifabutin+maraviroc Use standard doses Rifampicin+enfuvirtide No interaction; use standard doses Rifabutin+enfuvirtide No Etomidate interaction; use standard doses *Where combinations are not recommended, specialist HIV treatment advice should be sought. We recommend that therapeutic drug monitoring (TDM) of NNRTIs and PIs should be performed when drug regimens are complex. Drug levels of anti-tuberculosis drugs should be measured when there is clinical concern regarding absorption or response to TB therapy. Starting HAART during TB treatment is complicated by overlapping toxicities, drug interactions and immune reconstitution disease (IRD), and high pill burdens may reduce adherence. Delaying HAART may lead to prolonged or worsening immune suppression. Physicians have to balance these risks when deciding when to initiate HAART. Recent data suggest early treatment reduces morbidity and mortality. We recommend, where possible: CD4 consistently >350 cells/μL: at physician discretion; CD4 100–350 cells/μL: as soon as practicable, but can wait until after completion of 2 months of TB treatment, especially when there are difficulties with drug interactions, adherence and toxicities; CD4 <100 cells/μL: start HAART as soon as practicable after starting TB therapy.

Cells were grown in Balch medium III at 35 °C with shaking (Balch et al., 1979; Kalmokoff et al., 1988). An inframe deletion mutant in flaK derived from M. maripaludis Mm900 was described previously (Ng et al., 2009). These cells are nonflagellated, but piliated and complementation of flaK in trans restores flagellation. Using the flaK mutant as a starting host, the subsequent deletion of the prepilin peptidase eppA was accomplished using the technique of Moore & Leigh (2005). An approximately 1-kb region upstream

of eppA was amplified using the primers P1: 5′-CGCGGATCCCATTTCTATCAATTTTCCAC and P2: 5′-TTGGCGCGCCGGGGAATTATTCGCTCTTTGATAT. Primers P3: 5′-TTGGCGCGCCGGCGTTATAAATTATCTGGTGGGA and P4: 5′-CGCGGATCCCGTTTGACTGTTTGAACAGC STAT inhibitor were used to amplify approximately 1 kb downstream of the gene. Both P2 and P3 primers had AscI sites incorporated into them (underlined in primer), allowing for Palbociclib AscI cleavage of the two PCR products, followed by ligation and PCR amplification with primers P1 and P4 to generate an approximately 2-kb fragment that contained an inframe deletion version of eppA. Using the BamHI sites

incorporated into primers P1 and P4 (underlined), this piece was cloned into pCRPrtNeo and transformed into the existing M. maripaludis flaK deletion strain with transformants screened for the eppA deletion by PCR using primers P5: 5′-CTGGAGCTGTATGAAATGCAACTGG and P6: 5′-CCTGCATTATCCCAGGTCATCC, which amplify across the deleted region. Similarly, the same plasmid was transformed into the Mm900 strain and transformants screened for the Florfenicol eppA deletion leading to mutants that were wild type for flaK, but deleted only for eppA. Wild-type and mutants cells were grown for 18 h at 35 °C before ethanol-sterilized substrates to be tested for attachment were added. Incubation continued at 35 °C with gentle agitation for a further 24 h. Tested substrates

included various grids [200 or 400 mesh uncoated gold, nickel (Agar Scientific, Essex, UK) and molybdenum grids (Gilder Grids, Grantham, UK)], mica, silicon wafer chips (Agar Scientific) and glass. To examine whether surface contact influenced the production of pili, the flaK deletion mutant was grown on Balch medium III plates (with 1.5% w/v Noble agar) for 4 days. Colonies were removed, resuspended in medium and briefly centrifuged. The pellet was gently resuspended in 2% glutaraldehyde in 100 mM sodium phosphate buffer, pH 7.2–7.4, containing 2% w/v NaCl for 30 min and examined by transmission electron microscopy (TEM), as described below. Wild-type and mutant cells were examined by TEM to identify the presence of surface appendages. Cells were fixed with 2% glutaraldehyde in 100 mM sodium phosphate buffer, pH 7.2–7.

5, rhlA’-lacZ) and E. coli DH5α(pECP64, lasB’-lacZ) were used to detect the levels of C4-HSL and 3O-C12-HSL, respectively (Pearson et al., 1997). The supernatant of P. aeruginosa overnight cultures was collected as the AHL source, and ICG-001 molecular weight the AHLs were extracted as previously described (Pearson et al., 1995). Biosensor strains were cultured overnight and then diluted to OD600 nm of 0.1. The supernatant of P. aeruginosa was mixed with biosensor strains. To monitor C4-HSL, the mixture of E. coli DH5α(pECP61.5) and the P. aeruginosa AHLs extraction

was incubated at 37 °C to OD600 nm = 0.3, then 1 mM IPTG was added, and the mixture was cultured for another 5 h. To monitor 3O-C12-HSL, E. coli DH5α(pECP64) was used, and IPTG was also added when OD600 nm reached 0.3; the mixture was incubated at 37 °C for 90 min. After incubation, β-galactosidase activity of biosensor strains was measured as described by Miller (1998). Pyocyanin

was determined according to the method described previously (Essar et al., 1990). Pseudomonas aeruginosa strains were grown in LB at 37 °C for 16 h with shaking at 200 rpm. The P. aeruginosa culture was pelleted at 10 000 g for 10 min. Three ml of chloroform was added to 5 mL of the supernatant to extract pyocyanin. The chloroform phase was collected and mixed with 1.5 mL of 0.2 M HCl. Absorption of the aqueous phase at 520 nm was measured. The elastase activity was measured as described previously (Ohman et al., 1980). Bacterial strains were inoculated on LB plates that were spread with 0.4% elastin (Sigma). Following incubation at 37 °C for 24–48 h, the size of the hydrolysis ring Pifithrin-�� in vivo was measured to evaluate the capacity of Type II secretion system. Bacteria were cultured overnight in LB broth at 37 °C, and 20 μL cultures were seeded onto PGS plate (1% peptone, 1% NaCl, 1% glucose, 0.15 M sorbitol, 1.7% agar, 1 mM MgCl2, 1 mM CaCl2, 25 mM KPO4, pH 6.0) and incubated at 37 °C for 24 h. After additional incubation for 8–24 h at room temperature (25 °C), 60 of L4 stage N2 worms were placed on 4 PGS plates PIK-5 seeded with each bacterium and then grown at 25 °C again. Surviving

worms were scored at the indicated time points and transferred to a fresh plate every day. The worm was considered as dead when it gave no response to touch, and worms that died of accidental events were eliminated. Upstream primer pair: Full2950k1-s, TATCCTGGTTATCGCTGAGCACAAC and Full2950k1-anti, GTCGGCTTGGAATCGGGCTC and downstream primer pair: Full2950k2-s, GCTCCCGCTCCCCCGAAC and Full2950k2-anti, GGCGTCCTCTACTTCGTCCCG were used to generate pfm knockout construct. Two 943-bp fragments, upstream and downstream of the pfm, were amplified by PCR and ligated into EcoRI and HindIII restriction sites of pEX18Tc plasmid, resulting in a construct that is deleted of the pfm. This construct was introduced into PAO1, and a pfm deletion mutant was selected using the method described previously (Schweizer, 1992).

In the last study, where clinicians freely selected the restorative materials they used in their practices, seven used COM, one used conventional GI materials and one used a combination of the two types of material. “
“International Journal of Paediatric Dentistry 2010; 20: 112–118 Aim.  The aim of this study was to assess

the correlation between osteogenesis imperfecta (OI) and dentinogenesis imperfecta (DI) from both a clinical and histological point of view, particularly clarifying the structural and ultrastructural dentine changes. Design.  Sixteen children (6–12 years aged) with diagnosis of OI were examined for dental alterations referable to DI. For each patient, the OI type (I, III, or IV) was recorded. Extracted or normally exfoliated primary teeth were subjected to a histological examination (to both selleck products optical microscopy and confocal laser-scanning microscopy). Results.  selleck screening library A total of ten patients had abnormal discolourations referable to DI: four patients were affected by OI type I, three patients by OI type III, and three patients by OI type IV. The discolourations, yellow/brown or opalescent grey, could not be related to the different types of OI. Histological exam of primary teeth showed severe pathological change in

the dentin, structured into four different layers. A collagen defect due to odontoblast dysfunction was theorized to be on the base of the histological changes. Conclusions.  There is no correlation between the type of OI and the type of discolouration. The underlying dentinal defect seems to be related to an odontoblast dysfunction. “
“International Journal of Paediatric Dentistry 2012; 22: 390–396

Background  This paper aims to review the case of a girl who presented with a number of dental anomalies, in addition to unusual skin, nail and hair conditions. Tragically an undiagnosed cardiomyopathy caused unexpected sudden death. The case is discussed with reference to a number of dermatological and oral conditions which were considered as possible diagnoses. Case Report  AW had been under long term dental care for prepubertal periodontitis, Chloroambucil premature root resorption of primary teeth, soft tissue and dental anomalies, and angular cheilitis. Separately she had also been seen by several dermatologists with respect to palmar plantar keratosis, striae keratoderma, wiry hair and abnormal finger nails. Tragically the patient suffered a sudden unexpected death and the subsequent post mortem identified an undiagnosed dilated cardiomyopathy. Conclusion  The most likely diagnosis is that this case is a variant of Carvajal Syndrome with additional dental anomalies. To date we have been unable to identify mutations in the desoplakin gene. We aim to emphasise the importance of recognising these dental and dermatological signs when they present together as a potential risk factor for cardiac abnormalities. “
“Children suffer from somatic and dental pain, which may interfere with their everyday life.

Autoinduction mediated by AHL signals has been well described in the plant pathogen P. stewartii ssp. stewartii (von Bodman et al., 2003) and has been reported recently in the pathogens P. agglomerans pv. gypsophilae and P. ananatis (Morohoshi et al., 2007; Chalupowicz et al., 2008). Based on the sequence homology to the pagRI genes of

P. agglomerans pv. gypsophilae (Chalupowicz et al., 2008; Rezzonico et al., 2009) the transcriptional regulator pagR and the AHL-synthase pagI genes (Pvag_pPag30141–Pvag_pPag30142) have been identified on plasmid Trichostatin A price pPag3. Using an A. tumefaciens biosensor (Shaw et al., 1997), AHL production was tested. For this purpose, the plant pathogenic strain P. ananatis LMG 2665 was added to the assay as a positive control. Pantoea vagans C9-1 has a positive autoinducer functional activity, but yields a weaker signal in the biosensor assay than P. ananatis LMG 2665 (Fig. 2). The variant P. vagans C9-1W lost this activity (Fig. 2), confirming that this strain Tyrosine Kinase Inhibitor Library order is not able to produce detectable AHLs.

Although the chromosome also contains a putative AHL synthase, located next to the sdiA gene encoding a LuxR-type transcriptional regulator (Lindsay & Ahmer, 2005; Smits et al., 2009), it can be concluded from the results of the biosensor assay that this chromosomal gene is not involved in the synthesis of the AHLs that can be detected with the A. tumefaciens biosensor. The PagRI quorum-sensing system plays a central role in the virulence of P. agglomerans pv. gypsophilae by regulating the expression of the T3SS (Chalupowicz et al., 2009). Its role in the ecological behavior of P. vagans and P. agglomerans strains that have functional pagRI genes is currently unknown (Rezzonico et al., 2009). The fact that most nonpathogenic strains lack a T3SS, however,

suggests that pagRI may have additional non-virulence-related functions in phytopathogenic pathovars. Siderophores are small molecules that bind Fe3+ with a high affinity and are synthesized by bacteria under iron starvation. The genome of P. vagans C9-1 contains biosynthetic genes for the catecholate siderophore enterobactin (ent-fep) Carnitine dehydrogenase and the hydroxamate siderophore desferrioxamine E (dfoJACS), which were reported to be produced by the strain (Feistner & Ishimaru, 1996). Siderophore biosynthesis can be an important biocontrol trait, as the strain may be able to compete with phytopathogens for the already limited supply of iron in planta. When spotted onto CAS siderophore indicator plates (Schwyn & Neilands, 1987), P. vagans C9-1 produces a large halo, indicative of siderophore synthesis, while variant C9-1W produces a small halo, just around the colony (Fig. 3). This difference can be attributed to the absence of the pPag3-encoded dfoJACS gene cluster (Pvag_pPag30339–Pvag_pPag30342), which confers the ability of desferrioxamine production to the strain. Pantoea vagans C9-1W was compared with the wild-type strain P.

Matheus and colleagues[6] recently reported detecting dengue serotypes by (reverse selleck transcription polymerase chain reaction) in 90% of blood samples from NS1-positive dengue patients presenting in the French West Indies, using venous blood specimens collected on filter paper (via a finger prick) and shipped at ambient temperature to French Guiana for analysis. Such sample collection methods would afford opportunity to capture events that may occur in the field, far from a military medical facility. While the US military conducts surveillance for disease and non-battle injury (DNBI) in deployed forces, limitations of its DNBI surveillance include incomplete data capture in deployed settings

and lack of systematic laboratory testing for patients with infectious syndromes. Better surveillance for infectious diseases using field-expedient sample collection methods would lead to better public health prevention and treatment in deployed forces, and also could enhance vaccine research and development efforts through better understanding of pathogen molecular epidemiology. Specifically for dengue, phase 3 vaccine trials are underway, and understanding global epidemiologic patterns will be important in any future vaccine field effectiveness trials, particularly among deployed military populations that would be a target SGI-1776 in vivo population

for vaccination. In addition, such a surveillance system could also be integrated with vector surveillance programs to yield a robust Gefitinib early warning system for infectious

disease threats. Enhancing surveillance efforts among deployed military personnel is also important from global health and geopolitical perspectives. History shows that military populations can introduce new diseases into local populations,[7] most dramatically during the influenza pandemic of 1918 in Europe[8] and more recently from the possible importation of cholera into Haiti.[9] The need for improved military surveillance is especially significant in Africa, where US military engagement is expanding as part of its mission to achieve a more stable environment that promotes political and economic growth there. US military personnel continue to contract malaria[10-12] and dengue[13] during overseas operations. However, there is no systematic, integrated syndromic and laboratory-based surveillance for acute febrile illness in US military personnel in Africa. The United States has more than 3,000 service members deployed to Djibouti, an epidemiologically important country in the Horn of Africa with migrant populations traveling from Somalia, Eritrea, and Ethiopia, and a major port for produce and animal exports. Because of this geographic niche and limited local surveillance capacity, there is an important need to characterize infectious disease risks in the region.

001 mg kg−1. The levels of DON, 3ADON, 15ADON, and NIV were determined in pooled grain samples by GC-MS as previously described by Eskola et al. (2001). Each pooled sample (100 g) contained kernels pooled from c. 500 wheat heads per sample. Each sample was analyzed once. The limits of quantitation were 0.01 mg kg−1 for DON and its derivatives and 0.03 mg kg−1 for NIV. The relationships between the quantitated DNA

and trichothecene concentrations in grain samples were determined by Pearson’s correlation analysis Akt inhibitor using statistica software (Data Analysis Software System, version 6.1; StatSoft Inc., 2003, http://www.statsoft.com). The quantitation of transcripts of tri4, tri5, and tri11 genes located in the 12-gene core tri cluster (Brown et al., 2004) was evaluated using TaqMan probes. The proposed

trichothecene biosynthetic pathway in Fusarium has been presented in Foroud & Eudes (2009). The analyzed genes encode the first steps of the type B trichothecene biosynthesis pathway and are representative of the initial flux of the biosynthetic pathway. Tables 2 and 3 show fold-change values representing tri up-regulation in F. graminearum isolates treated with azoles as compared to nontreated control. The tri transcript levels were always higher in cultures supplemented with sublethal concentrations of azoles, although in some cases, fold-change values were not significantly selleck chemicals llc altered [P(H1) = 0.001]. Among the tri transcripts analyzed of all studied isolates, the amount of tri4 transcript was the highest during the culture process followed by tri11 and tri5 (data not shown). It should be noted that the tri transcript levels in nontreated samples differed among the tested DON and NIV chemotypes. The tri transcript levels of DON chemotypes were at a similar and higher level than in the NIV chemotype (data oxyclozanide not shown). Notably, the tri transcript levels seemed to be related to the type of azole used. Within DON chemotypes, the amount of tri transcripts treated with tebuconazole was higher compared to samples treated with propiconazole; however, such a relation was not clear

for the NIV chemotype (Tables 2 and 3). In an independent experiment, the levels of trichothecenes (DON, 3ADON, 15ADON, NIV, and 4ANIV) were determined in 14-day-old cultures supplemented or not with different concentrations of azoles (Table 2 and 3). Isolate 1002T, identified with qPCR assay as 3ADON genotype, accumulated DON and higher amounts of 3ADON. Isolate 1001T, determined to be of the 15ADON genotype, produced DON and lower amounts of 3ADON and 15ADON. Isolate 0357, predicted with qPCR assay as an NIV producer, accumulated NIV, 4ANIV. For 3ADON chemotype, an increase in DON and 3ADON was revealed in samples treated with all sublethal concentrations of propiconazole. However, all samples of 15ADON chemotype exhibited decreased accumulation of trichothecenes as compared to N.T.C.

ruber M7 in our laboratory (unpublished data), and we hope that further investigation Selleckchem Birinapant of these genes will improve

our understanding of the regulation mechanism of the G-protein signalling pathway in Monascus spp. We thank Dr Youxiang Zhou from the Food Quality Inspection and Testing Center of Agricultural Ministry of China in Hubei for his aid in citrinin HPLC analysis, and Dr Daohong Jiang from Plant Pathology, College of Plant Science and Technology, Huazhong Agricultural University, for providing vectors pCAMBIA3300 and pSKH. This research work was financially supported by the National High Technology Research and Development Program of the People’s Republic of China (863 Program: 2006AA10Z1A3) and Program for New Century Excellent Talents in University of the Ministry of Education Bcl-2 activation of the People’s Republic of China (NCET-05-0667). “
“A Caulobacter crescentus rho∷Tn5 mutant strain presenting a partially functional transcription termination factor Rho is highly sensitive to hydrogen peroxide in both exponential and stationary phases. The mutant was shown to be permanently under oxidative stress, based on fluorophore oxidation, and also to be sensitive to tert-butyl hydroperoxide and paraquat. However, the results showed that the activities of superoxide dismutases CuZnSOD and FeSOD and the alkylhydroperoxide Phospholipase D1 reductase ahpC

mRNA levels in the rho mutant were comparable to the wild-type control in the exponential and stationary phases. In contrast, the KatG catalase activity of the rho mutant strain was drastically decreased and did not show the expected increase in the stationary phase compared with the exponential phase. Transcription of the katG gene was increased in the rho mutant and the levels of the immunoreactive KatG protein do not differ considerably compared with the wild type in the stationary phase, suggesting that KatG activity is affected in a translational or a post-translational

step. Bacteria utilize two mechanisms for termination of transcription: intrinsic termination, determined primarily by cis elements in the mRNA, and a mechanism dependent on the trans-acting protein, Rho. Rho is a hexameric RNA/DNA helicase that binds to rut (Rho utilization) sites in mRNA, is translocated in an ATP-dependent process and eventually dissociates the transcription complex, resulting in transcription termination (Richardson, 2002; Ciampi, 2006). The importance of Rho-dependent termination in bacterial physiology is clearly established by the fact that rho is essential for viability in several well-studied Gram-negative species, Escherichia coli, Rhodobacter sphaeroides and Caulobacter crescentus (Das et al., 1976; Gomelsky & Kaplan, 1996; Italiani & Marques, 2005).

Expression of the obcA gene was able to restore the ability of the mutant to produce oxalic acid (Fig. 2b). The observed level of oxalic acid production, however, was much less than the wild type, suggesting that another essential component(s) was missing. This hypothesis was confirmed upon complementation of the Bod1 mutant Selleck AZD0530 with a larger 9-kb DNA fragment

(C1E2) containing the obcA locus (Fig. 2b). In an effort to identify the missing component(s), deletion analysis was performed on the 9-kb C1E2 fragment (Fig. 3a). Using the available restriction sites present on this DNA fragment, deletions were made to both the 5′ and the 3′ ends. Using this strategy, a second ORF was identified, which we refer to as the obcB locus. blast searches conducted using this gene revealed a 70% identity to an ORF from B. ubonensis as well as similarities to other bacterial acetyltransferases. This is in agreement with the proposed enzyme reaction mechanism and biochemical assay that has a requirement for acetyl-CoA (Li et al., 1999). To verify the role of both genes in oxalic acid production,

four different constructs were generated and expressed in E. coli (Fig. 3b). Escherichia coli is a bacterium that does not normally biosynthesize oxalic acid. As with the complementation assay, expression of the obcA locus alone resulted Ibrutinib chemical structure in the production of some oxalic acid, while expression of Erastin price the obcB alone did not result in any detectable

acid. Coexpression of obcA and obcB either as one continuous DNA fragment (obcA–obcB) or as separate DNA fragments (obcA+obcB) contained on the same vector resulted in increased oxalic acid levels, and thus confirmed the importance of both ORFs in oxalic acid production (Fig. 3b). Because both obcA and obcB are important in the biosynthesis of oxalic acid, are in close proximity to each other, and are encoded in the same transcriptional direction, it seemed likely that both genes could be encoded on a single polycistronic message. Such an arrangement of transcriptional control would also provide a plausible explanation for why complementation of the Bod1 (obcA knockout) with a functional copy of the obcA gene was not enough to fully restore the oxalate phenotype (Fig. 2b). To test this operon hypothesis, we performed a transcriptional analysis using RT-PCR and gene-specific primers (Fig. 4a and b). Genomic DNA was used as a positive template control and total RNA (without running the RT reaction) was used as a negative template control. All primer pairs used in the RT-PCR experiment resulted in the generation of a DNA fragment of the expected size, indicating that the obcA and obcB genes were indeed encoded on a single polycistronic message and were thus structured into an operon. Overall, it appears that a molecular-genetic approach will be useful in deciphering the oxalic acid biosynthetic pathway in bacteria.

Aliquots of PCR products were checked by electrophoresis on a 2% agarose gel. The PCR products obtained for the six strains were sequenced and aligned using clustalx (Thompson et al., 1997). Variable nucleotides between the sequence of Fo47 and those of other strains were used to design two primers potentially specific

for Fo47. The specificity of these primers was tested in conventional PCR reactions as described above. Real-time PCR reactions were performed on an ABI PRISM® 7900HT Sequence Detection System (Applied Biosystems®, Foster City, CA). The PCR mixtures were set up as follows: 5 μL of DNA (5 ng), 0.3 μM of each primer P47C and P47D, 12.5 μL of the SYBR green master mix (Quanti Tech SYBR Green kit, Qiagen Gmbh, Hilden, Germany), 0.5 μg of T4 gene

32 protein (Quantum-Appligene, France) and Mol Bio grade water (5 Prime Gmbh, Hamburg, Germany) in a final volume of 25 μL. In the negative click here and positive controls, DNA was replaced by Mol Bio grade water and Fo47 DNA, respectively. The program used for PCR was: 1 min at 95 °C, followed by www.selleckchem.com/products/FK-506-(Tacrolimus).html 35 cycles of denaturation for 15 s at 95 °C, annealing for 30 s at 60 °C, extension for 30 s at 72 °C and data collection after 30 s at 78 °C to eliminate parasitic peaks. A dissociation curve was included at the end of the PCR program to evaluate potential primer–dimers and nonspecific amplification products. A standard curve based on Ct values vs. known quantities of target DNA was constructed using the plasmid that contained the cloned genomic fragment of the strain Fo47. Plasmid DNA was extracted using the QIAfilter

plasmid purification kit (Qiagen, Courtaboeuf, France) and linearized using the restriction enzyme SalI (Q-BIOgene). A standard curve in each microplate was obtained by amplification of 10-fold dilution series (102–108) of the linearized plasmid containing the SCAR from Fo47. Similarly standard curves were constructed by mixing dilution series of plasmid (102–108) or fungal DNA (10–104 pg) with 5 ng of plant DNA. The specificity of primers for the real-time PCR assay was tested with DNA extracted from the five strains used to design the primers, 12 additional strains of F. oxysporum, and three strains belonging to other Fusarium spp.: Fusarium redolens, Fusarium moniliforme, Fusarium solani (Table S1). Both Fo47 and F. oxysporum f. sp. lycopersici 8 (Fol8, ATCC number MYA-1199) strains were used. Inoculum CYTH4 was prepared according to L’Haridon et al. (2007). The concentration of the conidial suspension was adjusted to the desired concentration using sterile-distilled water. Tomato (Solanum esculentum) cv. Montfavet 63-5, which is susceptible to Fusarium wilt, was used to analyze the root colonization by Fo47. Tomato plants were cultivated in soil originating from a field in Epoisses (Bretennières, France) passed through a 4-mm sieve. It is a silt loamy soil with 50% silt, 41% clay, 9% sand and 2.6% organic matter, pH 8.2. The soil was used either nontreated or heat-treated at 100 °C for 1 h.