For collagen I, II, and X detection, slides were incubated in Alexa Fluor 555, 488, and 555 goat anti-rabbit antibody (Invitrogen, diluted 1:500), respectively, for 30 min and then

mounted with DAPI mounting medium (Vector Laboratories). To detect cell death, TUNEL (In Situ Cell Death Detection Kit, Roche) was performed as described by the manufacturer. Imaging of the stained tissue sections was performed with a Leica DM 5000B fluorescent microscope and a Leica DFC 500 digital camera. Mucoperiosteal denudation was performed and animals were sacrificed at 7, 14, 21, and 28 days (Table 1). Tissues from all mice were harvested by microscopic dissection EPZ5676 in vitro from 8 injured and 8 control mice for each of the four time points reported, for a total of 64 mice (Table 1). The epidermis was removed and the midpalatal suture complex, which included the medial edges of the palatine bones, its growth plates, and the fibrous interzone, was collected then homogenized in TRIzol (Invitrogen). RNA was quantified, and qRT-PCR was performed (Quantace Bioline, Taunton, MA). Expression levels were calculated using the 2Δ-(ddCt) method,

normalized to GAPDH [29], and converted to fold-expression. Pirfenidone mw The following primer sets were used: GAPDH, acccagaagactgtggatgg and ggatgcagggatgatgttct; Sox9, agaacaagccacacgtcaag and cagcagcctccagagctt. ALP, accttgactgtggttactgc and catataggatggccgtgaagg; OPN, catgaagagcggtgagtctaag and ttccagacttggttcatccag. Micro-CT

scanning (Imtek/Siemens MicroCAT II/SPECT system, 52 μm resolution) was performed from using six injured and six age-matched control mice on PID28. Scanning results were exported into DICOM format and Osirix software version 5.8 (Pixmeo, Bernex, Switzerland) was employed to render the 3D multiplanar reconstruction in order to evaluate coronal sections across the midpalatal suture complex at exactly the same axis for each sample. Distances between left and right palatine foramen were measured and reported as inter-foraminal width. These skeletal landmarks were used as fiducials to assess the effect of the mucoperiosteal denudation injury on mediolateral expansion of the hard palate. For histomorphometric analyses, tissues from 6 injured and 6 control mice were used for each of the four time points reported, for a total of 48 mice (Table 1). The palate was sectioned at 8 μm thickness/section and collected from the area bound by the first and second molars, corresponding to the middle region of the injury. Each slide contained two tissue sections. From the resulting ~ 30 slides, 6 slides were chosen (one every fifth slide) in order to perform the following quantifications. Tissue sections were stained with Ki67, Safranin O, or TUNEL protocols.

All patients had a minimum of 12 months of Medicare enrollment prior to the date of EC diagnosis. Patients with a diagnosis of EC undergoing EUS within the period 1 month prior or 3 months after date of diagnosis were compared to pts who did not. Survival times were estimated by Kaplan-Meier method and compared by using log-rank test. Multivariable Cox proportional hazards models were used to compare 1, 3 and 5 yr survival rates adjusted for age, race, gender, tumor histology, tumor stage, SEER site, year of diagnosis, see more Medicare/Medicaid dual enrollment and Charlson comorbidity index. Of a total of 5247 patients

[mean age 75.8 years, 71% men, 87% White, 55% esophageal adenocarcinoma (EAC)] that met the inclusion criteria, only 524 (10%) underwent evaluation by EUS. On univariate analysis, younger (p<0.0001), White (p=0.0002) pts with EAC (p<0.0001)

were more likely to undergo EUS (Table 1). Higher survival rates were noted in pts undergoing EUS for all cancer stages except carcinoma in situ (p<0.0001 for all). Pts who were evaluated by EUS were more likely to be treated with endoscopic therapy (p<0.0001), chemoradiation (p=0.01) and esophageal resection (p=0.002). Multivariable Cox proportional NVP-BKM120 research buy hazards models showed that receipt of EUS was associated with improved all-cause survival [1 yr: HR 0.54 (95% CI 0.46-0.62), 3 yr: HR 0.6 (0.54-0.68), 5-yr: HR 0.61 (0.55-0.68)]. Older age, black race, histology other than EAC, increasing tumor stage, and higher comorbidity score were all significant predictors

of decreased survival (Table 2). Improved survival was also noted in a subgroup analysis based on histology [1 yr: EAC: HR 0.59 (95% CI 0.49-0.71), ESCC: HR 0.48 (95% CI 0.36-0.63)]. This large population-based study demonstrates that performance of EUS is associated with an improved 5-year survival in patients with EC (40% risk reduction). This may be attributed to the high accuracy of staging by EUS leading to stage-appropriate management, a hypothesis supported by increased use of endoscopic and surgical treatment in patients receiving EUS. However, only a minority of eligible patients with EC undergo EUS based evaluation. Table 1. Univariate analysis comparing individuals with esophageal cancer Buspirone HCl undergoing EUS (Group 1) to those not undergoing EUS (Group 2) “
“The most important parameter for determining the optimal treatment of upper gastrointestinal tumors is accurate staging accomplished by TNM classification. However, the diagnosis of intra-abdominal lymphadenopathy is often a challenge for endoscopists and radiologists. Contrast-enhanced harmonic EUS (CH-EUS) allowed observation of microvasculature in digestive organs. The aims of this prospective study were to observe the microvasculature of intra-abdominal lymphadenopathy by CH-EUS and to evaluate its usefulness for discriminating between malignant and benign lymph nodes.

The incidence of

diagnosed VTE during residence in the current study was higher than reported in 3 earlier nursing home studies16, 17 and 18 but equivalent to that of a second of 2 databases in one of these studies.16 Compared with the current study finding of 3.68 cases per 100 PY, VTE incidence rates in nursing home studies were 1.2 to 1.5 (MCMRP data/Minnesota),16 3.6 (Rochester Epidemiology Project data/Minnesota),16 1.3 (MDS and Medicare data/Kansas),17 and 1.4 to 1.6 (medical chart data/Israel)18 per 100 PY. The high incidence rate found in our study may be a consequence of differences in the pool of nursing homes studied Epigenetics inhibitor (eg, a potentially greater number of residents receiving subacute care) or in the methods used, or it may be due to the later time period (2007–2009) than the earlier studies (1988–2001). The effect of changes in resident case-mix or a historic trend in the incidence of VTE remain unknown given the

lack of details in the current and earlier studies regarding levels of resident acuity and changes in criteria to diagnose VTE. Findings Docetaxel cell line from the Rochester Epidemiology Project16 would suggest that the MDS might be undercounting the incidence of fatal VTE, especially because residents who die in the hospital after nursing home discharge are less likely to have VTE recorded in the final MDS assessment. PE events may be especially undercounted. In a recent national study25 of hospitalizations with a diagnosis of VTE, the ratio of DVT to PE was much lower than our findings: crude estimated average annual rates in that study were 0.152 (DVT) and 0.121 (PE) per 100 hospitalizations, respectively; the relative proportion due to PE declined with advancing age, although in an earlier community study,6 the inverse

relationship was observed. The high incidence rate observed in our study SPTLC1 might also be a consequence of the growth in associated risk factors among hospitalized patients admitted to nursing homes in recent years with high disease acuity, short hospital stays, and increased use of surgical and other interventional procedures. Improved diagnostics for recognizing asymptomatic VTE may be a key factor, although we have no means of describing how newer diagnostics, such as portable Doppler ultrasound, have affected incidence rates over time. Stein et al26 found that the incidence of DVT in hospitalized patients increased from 0.8% to 1.3% of all hospital admissions over the period 1979 to 1999, yet the incidence of PE remained unchanged at 0.4%. These authors hypothesized that increased use of venous ultrasound may have increased DVT incidence, and early diagnosis and treatment of DVT may have prevented a concurrent rise in PE.26 Our study found a 1:5 ratio of PE cases to DVT cases during residence.

Thus, the ethical criteria, which have to be considered for the application of HBM in CBRN scenarios, are comparable with the general ethical issues of medical diagnostics (Engelhardt, 1980 and Decker et al., 2013). Communication is another crucial issue in the whole process. It comprises crisis communication with the exposed groups and the public and individual communication

with trained crisis intervention personnel and physicians. In line with the ethical guidelines of medical diagnostics for HBM the acting physician needs to inform the patient on the tasks and risks of the planned examination and request PS 341 an informed consent of the patient prior to the sampling of the specimens. Therefore a ready-to-copy informed consent form is part of the compendium. Ideally the physician can give the patient information on the medical follow-up while collecting the sample. If this is not the case a contact point, e.g., the local public health authorities, needs to be assigned by the on scene commander

to coordinate crisis/risk communication and communication of HBM results in the aftermath. selleck chemicals Prior to sample collection exposed persons have to be decontaminated to avoid exposure of the medical personal. Basic rules of hygiene and personal protection have to be obeyed during the sampling process. In a medical interview the physician may ask for personal data and general HBM influencing factors like smoking, medication

and food consumption, e.g., eating fish and seafood modulates selleckchem levels of arsenic in blood and urine. In addition self-reported exposure data shall be gathered. This comprises time-point and duration of exposure, status (person of the general population/member of the disaster relief forces), proximity to the source of exposure, personal or technical protection equipment (yes/no), signs of intoxication and medical treatment so far. For self-reported exposure data a ready-to-copy form is included in the compendium, the human specimens collected can be documented on the same data sheet. The generated documents and the collected specimen(s) need to be assigned to the exposed individual without doubt anytime during the HBM process. Ideally a unique code number or barcode label(s) supplied by the HBM laboratory are used for this purpose. As already indicated in the introduction the ultimate safe-guarding of samples in line with the “public interest–legal liability approach for the application of chemical incident HBM” is the preferred way to implement HBM in a CBRN incident in Germany. Therefore, if the substance is unknown or a HBM method for a known substance is not available urine sampling is requested for “validated HBM” after the development of a new HBM analysis method.

It has been documented that high-density microplastics can be temporarily suspended within the water-column in smaller numbers

www.selleckchem.com/products/3-methyladenine.html resulting from turbulence. High-density microplastics can remain in suspension when entering the sea through estuaries due to tidal fronts, high-flow rate or because of a large-surface area (Browne et al., 2010). Only when momentum is lost will these dense polymers inevitably sink (Barnes et al., 2009). Microplastics on the seabed may also be re-suspended resulting from turbulence: Lattin et al. (2004) quantified microplastic concentrations >333 μm at varying depths, 0.8 and 4.5 km off the southern Californian coast. At the off-shore site, microplastics were most abundant close to the seafloor (6 items/m3), but were redistributed throughout the water column after a storm (Lattin et al., 2004). Since the 1940s, when the mass production of plastics began in earnest, the volume of plastic produced has risen rapidly. With legislation to curb the indiscriminate disposal of plastic waste emerging slowly, plastic debris entering the marine environment increased in parallel with rates

of production during this time (Moore, 2008; Ryan et al., 2009 and Barnes et al., 2009). Continuous fragmentation of larger plastic debris and the rising popularity of “plastic scrubbers” appears to have increased the volume of microplastic debris in the oceans, LDK378 chemical structure resulting in a decrease in

the average size of plastic litter over time (Barnes et al., 2009). This was highlighted by Thompson et al. (2004), who demonstrated that microplastic concentrations in the 1980s and 1990s were significantly greater than those in the 1960s and 1970s in an analysis of CPR samples from the North Sea and Northwest Atlantic. Furthermore, incidence of plastic ingestion by Fulmars (ocean-foraging seabirds), washed ashore in the Netherlands, increased from 91% to 98% between the 1980s and 2000, whilst the average consumption doubled from 15 to 30 plastic fragments per bird during this period (van Franeker et al., 2011). Concentration trends within the past decade are not overtly apparent, and there is some debate Methane monooxygenase as to whether levels of plastic debris are still increasing or have stabilised. The study by Thompson et al. (2004) indicated minimal change in microplastic contamination between the 1980s and 1990s. Similarly, an evaluation of >6, 100 surface trawls conducted throughout the Northwest Atlantic Ocean found no significant difference in microplastic abundance over a 22 year period (Law et al., 2010). The average number of plastics debris items consumed by Fulmars, beached on the shores of the Netherlands, decreased slightly from the mid-1990s, but has remained relatively stable since the turn of the century, currently averaging 26 plastic fragments per bird (van Franeker et al., 2011).

7.13.3), and ubiquitin-conjugating enzyme (EC 6.3.2.19). Many enzymes in the latter cases are large protein complexes, or large paralogue groups, and enzymes acting on macromolecules (such as DNA, RNA and proteins). The Enzyme List began before the accumulation of amino acid sequence data. Researchers

who find new enzymes are encouraged to contact to IUBMB to report them. When registering new enzymes, required information is mostly reaction based, such as proposed sub-subclass, accepted name, synonyms, reaction catalyzed, co-factor requirements, brief comment on specificity, other comments and references. There are many EC numbers that are not used for genome annotation because of the lack of sequence information. Among the 4150 EC numbers, 1454 (35%) do click here not correspond to any sequence data in KEGG nor UniProt. Some of these EC numbers

were determined before the establishment of GenBank, but other EC numbers were determined after that, although the sequence information remains unregistered for some reason. We suggest that the learn more Enzyme List should include more information about enzyme proteins, such as a sequence database identifier (if any is available), source organism name and taxonomy identifier (if any is available). At the same time, there should be a clear distinction between the original EC number given to an experimentally characterized enzyme in a specific organism and the deduced EC numbers given to other organisms based Amylase on sequence similarity. This would facilitate stronger links between the genomic and metabolomic information, and greatly enhance the utility of the Enzyme List. The quality of genome and chemical annotation determines the quality of theoretically and experimentally reconstructed biological networks, which in turn contribute to various studies on human health, environmental biology, etc. As the number of published experimental

evidences increases, it is becoming more important to attach quantitative and qualitative descriptors to genome annotations and databases. As the number of published studies containing experimental evidence of new enzymes, metabolites and gene interactions is continually increasing, it becomes vital to attach quantitative and qualitative descriptors to genome annotations and integrate them into existing databases None of the authors have any conflict of interest. The computational resources were provided by the Bioinformatics Center, Institute for Chemical Research, Kyoto University. The KEGG project is supported by the Institute for Bioinformatics Research and Development of the Japan Science and Technology Agency, and a grant-in-aid for scientific research on the priority area ‘Comprehensive Genomics’ from the Ministry of Education, Culture, Sports, Science and Technology of Japan. “
“During the year 2012 about one million scientific papers were published and entered into the literature database Pubmed (Sayers et al., 2011).

In addition, the magnitude of a trend was also estimated by the method of Hirsch et al. (1982) extended from Sen (1968). The Pettitt test (Pettitt, Mdm2 inhibitor 1979) is also a non-parametric test. It arbitrarily splits a time series into two sub-samples and implement a rank-based comparison between them. For a time series X(n), the separated two sub-samples before and after the date τ, Pettitt statistics k(τ) can be

computed as follows: equation(6) k(τ)=∑i=1τ∑j=τ+1nsgn(xj−xi)where sgn is defined as in Eq. (1). The abrupt change most likely takes place at the date τ where the absolute value of k(τ) reaches the maximum. Therefore, the final Petitt statistics K and time of the abrupt change T are introduced as follows: equation(7) T=argmax1≤τ≤n(|k(τ)|) equation(8) K=max1≤τ≤n(|k(τ)|) The significance probability associated with the rejection of the assumption that there is no change is approximated by: equation(9) p≈2exp−6k2n3−n2 Pettitt test reports the greatest likely change point in a time series. In this study the two-sample t-test was also used to determine if the two sets, before and after the detected change point, are significantly different from each other. The hydrometeorological series is identified to exhibit a significant abrupt change only when the result of t-test is true. Trends of the seasonal and annual

streamflow series from the gaging stations located in the upper and middle HRB were tested using the MK test. To discuss the streamflow response to the change in climate selleck products factors, trends of the annual and seasonal precipitation and mean temperature series were also analyzed by the MK test. Significance Bacterial neuraminidase level of α = 0.05 and α = 0.01 were used in the MK test. Abrupt changes of the annual streamflow, precipitation and mean temperature series were detected based on the Pettitt method with a significance level of α = 0.05. Because the EWDP on the mainstream of Heihe River was initiated in 2000 which significantly altered the streamflow

distribution in the middle and lower HRB, we computed the trends of the streamflow series both to 2000 and to the present. Fig. 2 and Fig. 3 depict the results of the MK test of annual streamflow data for the two series, one labeled “By 2000” and the other “Entire series”. For the annual streamflow series up to 2000, a significant trend was detected on only two stations located on the mainstream. One is the Qilian station (QL) in the upper stream where a significant upward trend was found (marked as a larger upward triangle in red in Fig. 2) with a Z-value of 2.12 (see Fig. 3), the other is Zhengyixia station (ZY) where a significant downward trend was identified (marked as a larger downward triangle in green in Fig. 2) with a Z-value of −2.87 (see Fig. 3). Trends of annual streamflow for all the other stations are generally insignificant.

The phase IIa TUCSON study [14] aimed to determine the safety, tolerability, and activity of perflutren-lipid

MBs MRX-801 plus TCD insonation in sonothrombolysis. Thirty-five patients with pretreatment proximal intracranial occlusions on TCD were randomized (2:1 ratio) to increasing doses of MRx-801 MBs infusion over 90 min. The study was terminated prematurely by the sponsor because of bleeding events in the 2nd dose tier, although all the 3 bleedings could have been attributed to very severe strokes and high blood pressures during treatment. Despite that, a trend toward higher sustained complete recanalization rates in both MBs dose tiers compared to control was observed (67% for Cohort 1, 46% for Cohort 2, and 33% for controls, p = 0.255). To date this

was the last sonothrombolysis study also using MBs, and the concept remains to be rechallenged in the authors’ opinion. Early PLX4032 order and effective reperfusion is the key for early ischemic tissue rescue and further good clinical outcomes. However, i.v. tPA alone can only accomplish this goal in less than 50% of the patients. Ultrasound may be a tool to enhance clot lysis, albeit the final verdict has to be spoken. At the current stage a phase III trial with an investigator blinded 2 MHz device using the settings of the original CLOTBUST study is underway, and the protocol has been finalized. Future research should be dedicated to optimizing the technical setting ERK inhibitor library of ultrasound, the development of untargeted and targeted MBs and optimizing the feasibility of this not so novel therapeutic approach

to acute stroke. Peter D Schellinger is Honoraria, Advisory Board, Travel grants, Speaker for Board for Boehringer Ingelheim, Coaxia Inc., Photothera, Cerevast, ImARX, Sanofi, Ferrer, ev3/covidien, GSK, Haemonetics, Bayer. Carlos A Molina is Honoraria, Advisory Board, Travel grants, Speaker Board for Boehringer Ingelheim, Coaxia Inc., Cerevast, ImARX, Sanofi, Ferrer, Haemonetics. “
“Sonothrombolysis has been introduced for treatment of acute intracranial occlusions during the first years of the last decade. Improved recanalization has been demonstrated with “diagnostic” transcranial ultrasound (US) in combination with standard intravenous (IV) thrombolysis with recombinant tissue-plasminogen activator (rtPA) in two randomized trials [1] and [2]. A study with limited sample size on middle cerebral artery (MCA) main stem occlusion has indicated that this method might be a possible alternative to interventional therapy [2]. The occurrence of an increased rate of symptomatic hemorrhagic transformation of brain infarction after sonothrombolysis with diagnostic US has not been confirmed thus far [3]. In the absence of other therapies (e.g.

Skuteczność L. reuteri w zespole Epigenetic inhibitor jelita drażliwego badali Niv i wsp. [36]. Przeprowadzili oni badania, w których podawano pacjentom L. reuteri 108 CFU 2 razy na dobę przez 6 miesięcy. Badania były randomizowane i kontrolowane placebo. Nie wykazano znaczących różnic pomiędzy grupami, a jedynie nieznaczną poprawę w zakresie zaparć i wzdęć w grupie badanej. Autorzy zaznaczają, że na wyniki wpływ mogła mieć niejednorodność grupy pacjentów z IBS. Analizowano także możliwość zastosowania L. reuteri w czynnościowych bólach brzucha u dzieci. Romano i wsp.

[37] zakwalifikowali do badania 60 dzieci w wieku od 6 do 16 lat, u których zgodnie z III kryteriami rzymskimi rozpoznano czynnościowe bóle brzucha. Pacjentom podawano L. reuteri DSM 17938 w dawce 2 × 108 CFU dziennie lub placebo przez 4 tygodnie. Obserwacja trwała jeszcze przez kolejne 4 tygodnie. Analizowano częstość i intensywność bólów brzucha. Stwierdzono, że dzieci otrzymujące verum opisywały ból brzucha jako mniej intensywny w porównaniu

z dziećmi otrzymującymi placebo. Trudnym problemem okresu niemowlęcego pozostaje kolka niemowlęca. Zwykle podawanie różnych preparatów leczniczych przynosi poprawę niepełną i na krótko, co wymusza częste zmiany leków z uwagi na uciążliwość dolegliwości. Savino i wsp. [38, 39] badali możliwości PFT�� order zastosowania L. reuteri w kolce niemowlęcej. W ich pierwszym badaniu wzięło udział 90 niemowląt z kolką, karmionych naturalnie, BCKDHB których matki unikały mleka krowiego w diecie własnej. Dzieci losowo przydzielono do grup, z których w jednej stosowano simetikon w dawce 60 mg/d

a w drugiej L. reuteri w dawce 108 CFU/d przez 28 dni. Stwierdzono, że podaż probiotyku, bardziej niż simetikonu, zmniejsza czas płaczu związanego z kolką, a efekt ten jest tym większy, im dłużej trwa suplementacja. Różnicę odnotowano już po 7 dniach leczenia, ale była ona zdecydowanie większa po 28 dniach. Nie obserwowano objawów ubocznych. W związku z tym uznano, że L. reuteri może być stosowany leczniczo w kolce niemowlęcej [38]. W niedawno opublikowanym badaniu tych samych autorów [39] udział wzięło 50 niemowląt karmionych wyłącznie naturalnie, z kolką niemowlęcą, u których losowo podawano L. reuteri 108 CFU na dobę lub placebo przez 21 dni. Monitorowano dzienną ilość godzin płaczu oraz występowanie efektów ubocznych. Stwierdzono istotnie większe zmniejszenie czasu płaczu dzieci suplementowanych L. reuteri w porównaniu z grupą kontrolną. Dodatkowo odnotowano korzystne zmiany mikroflory jelitowej. Nie stwierdzono pomiędzy grupami różnic w zakresie przyrostu masy ciała, częstości wypróżnień, występowania regurgiracji ani efektów ubocznych. Zatem stwierdzono, że L. reuteri łagodzi przebieg kolki niemowlęcej i jest dobrze tolerowanym i bezpiecznym lekiem. Dość często występującą dolegliwością u niemowląt jest ulewanie.

The main objectives of this study were (i) to evaluate the GY potential of new indica hybrid cultivars in China; (ii) to explore the complex correlations between rice GY and yield-related traits in a large pool of high-yield genotypes or cultivars; and (iii) to evaluate the stability of yield-related traits over time and across locations for the new indica hybrid cultivars. Two experiments were performed. The first was performed over the 2007–2008 ERK inhibitor purchase growing seasons in Taoyuan village, Yongsheng county, Yunnan province (26°13′ N, 100°34′ E, 1170 m a.s.l.), to investigate the relationships between several traits influencing yield. Newly released indica rice cultivars

(53 cultivars in 2007 and 48 cultivars in 2008) were grown on a farm during the rice growing seasons, which occurs from mid-March to mid-September. The second experiment was performed in both Taoyuan and Nanjing, Jiangsu province (32°2′ N, 118°42′ E, 80 m a.s.l.) from 2005 to 2008, to investigate variation in yield-related traits. Two typical Chinese indica F1 hybrid cultivars, a large-panicle cultivar, II You 107, and a heavy-panicle cultivar, Xieyou 107, were planted during the rice growing

seasons. The soil at Taoyuan was an OrthicAcrisol (FAO taxonomy) with pH 8.0, an organic carbon content of 12.4 g kg− 1, and a total nitrogen content HKI 272 of 2.0 g kg− 1. The soil at the Nanjing site was an OrthicAcrisol with pH 7.3, an organic carbon content of 6.7 g kg− 1, and a total nitrogen content of 1.1 g kg− 1. Both experiments were arranged in a completely randomized block design with three replicates. The area of a plot was 4 m × 5 m = 20 m2. Seedlings 30-day-old raised in a wet nursery were transplanted tuclazepam in early April at the Taoyuan site, and seedlings 35-day-old raised

in a dry nursery were transplanted in mid-June at the Nanjing site, with hill spacing of 0.3 m × 0.13 m and one seedling per hill at both sites. Nitrogen (125 kg ha− 1 N as urea), phosphorus (150 kg ha− 1 P2O5 as single superphosphate), potassium (150 kg ha− 1 K2O as K2SO4), and zinc fertilizer (15 kg ha− 1 Zn as magnesium–zinc fertilizer) were incorporated in the Taoyuan site, and 105 kg ha− 1 N as urea, 75 kg ha− 1 P2O5 as single superphosphate, 75 kg ha− 1 K2O as KCl, and 15 kg ha− 1 Zn as magnesium–zinc fertilizer were incorporated in plots in the Nanjing site one day before transplanting. In the Taoyuan site, additional N was applied 7 days after transplanting (125 kg ha− 1), 12 days after transplanting (62.5 kg ha− 1), panicle initial (PI) (187.5 kg ha− 1), and the stage of the 2nd leaf from the top extension (125 kg ha− 1). An additional 150 kg ha− 1 K2O was also supplied at the PI stage.