Advances in our understanding of two major human pathogens, hepatitis B virus (HBV) and hepatitis C virus (HCV), have been limited by a lack of suitable model systems for their study. Surrogate systems such as HBV recombinant baculoviruses have been developed to allow in vitro studies of HBV biology in the face of a lack of cell lines permissive to infection by this agent. The generation of infectious HCV culture systems has also allowed progress in the study of HCV virology. However, restriction of tropism of the available learn more cell culture infectious HCV strains to hepatocellular carcinoma cell lines has constrained

the general applicability of findings from these systems to events occurring in infected primary hepatocytes. The recent development of a model in which primary human hepatocytes have been shown to be rendered susceptible to persistent HCV infection when supported in an in vitro culture by stromal elements1 may allow significant advances in in vitro modeling of HCV biology. Despite such recent advances in in vitro options for the study of hepatotropic viruses, in vitro cell culture systems do not selleckchem necessarily recapitulate in vivo cell differentiation and function or virus-cell interactions in the infected host. Progress in the in vivo study of hepatotropic viruses

has been constrained by the narrow host range of HBV and HCV. Productive infection by HBV and HCV is limited to humans and chimpanzees, and although important advances in this field

have been made by analyses of infected chimpanzees, sizable studies are limited by ethical considerations, high cost, and limitations on availability. Studies of the Pekin duck and woodchuck models have led to advances in our understanding of hepadnaviruses; however, we are hampered by the outbred nature of these models and by a lack of available data on the immunobiology of these hosts and the restricted availability of suitable reagents. Attempts to develop small animal Obeticholic Acid research buy models for HCV have been impeded somewhat by similar limitations, and attempts to infect primates other than chimpanzees with HCV have not been successful. The development of HBV transgenic mice has been critical in revealing the mechanisms of control of HBV replication,2 but although transgenic animals produce infectious virus, murine hepatocytes are not susceptible to HBV infection. Largely because of the restricted tropism of HBV and HCV, attempts to develop small animal models for the study of human hepatotropic virus have recently centered on the creation of human liver chimeric immunodeficient mice. The first developed and best characterized of these systems is the one based on transgenic mice expressing urokinase plasminogen activator (uPA) in hepatocytes under the albumin promoter (Alb-uPA mice).

We demonstrated GKT137831 to be specific for NADPH oxidases over other flavoprotein-containing oxidases and also excluded the possibility that GKT137831 is a general ROS scavenger: GKT137831 was further tested in a xanthine oxidase (XO) assay using similar ROS production methodology as in our proprietary NOX assays and with the same readout. Whereas DPI showed high affinity (Ki = 50 nM) consistent with its nonspecific mechanism of action, GKT137831 demonstrated no affinity

for XO (Ki > 100 μM) (Fig. 2B,C) as well as the inability to scavenge superoxide (O2.−), the common endproduct of Nox proteins and XO. To further demonstrate the specificity of GKT137831 for Nox enzymes, our candidate drug was subjected to an extensive in vitro off-target AZD8055 order pharmacological profile on 170 different proteins, including ROS-producing and redox-sensitive enzymes, as well as representative proteins of well-recognized drug target families, such as G-protein-coupled receptors, kinases, ion channels, and other enzymes.25 GKT137831, when tested at 10 μM, did not show any significant inhibition of any tested target protein, demonstrating the excellent specificity of this compound

(see Supporting Table 2). To investigate the role of SOD1 and the effect of NOX1/4 inhibition on liver fibrosis, liver fibrosis was induced in SOD1mu (with increased catalytic activity) and WT mice by 12 consecutive CCl4 injections over a 6-week period. During the last half of CCl4 injections, some mice were treated with GKT137831 daily. CCl4-induced liver fibrosis was more pronounced in SOD1mu, compared to selleck compound WT, mice. Liver fibrosis in both SOD1mu and WT mice was attenuated by GKT137831

treatment. The NOX1/4 inhibitor reduced the levels of hepatic collagen deposition in CCl4-induced fibrosis in SOD1mu and WT mice to the same low level, as assessed by Sirius Red staining and its quantification (Fig. 3A,B). mafosfamide Hepatic α-SMA expression, a marker for HSC activation, was enhanced in SOD1mu mice after CCl4 injections, compared to WT mice, as assessed by IHC and immunoblotting. The increased hepatic α-SMA expression was markedly decreased in SOD1mu mice treated with GKT137831 to a level similar to that of WT mice given the NOX1/4 inhibitor (Fig. 3C,D). The mRNAs of fibrogenic markers, including collagen α1(I), tissue inhibitor of metalloprotease 1 (TIMP-1), and TGF-β were increased in SOD1mu mice to higher levels than in WT mice after CCl4 injections, but treatment with GKT137831 reduced the induction of those genes to the same lower levels (Fig. 3E). Similarly, BDL-induced hepatic fibrosis in both WT and SOD1mu mice was decreased by treatment with GK137831 (Supporting Fig. 1). Thus, both hepatotoxin (CCl4)- (this study) and cholestasis (BDL)-induced (this study and REFA) liver fibrosis is suppressed by blocking NOX1 and NOX4. To investigate the role of SOD1 and the effect of NOX1/4 inhibition on liver inflammation, macrophage infiltration and activation were evaluated.

These tumors comprise 2–5% of all EMPs and tend to be identified Bioactive Compound Library research buy late unless an endoscopic examination is performed Methods: We report a rare case of gastric plasmacytoma that was treated with endoscopic resection and oral thalidomide therapy. A 70-year-old man was admitted because of indigestion. He had no specific medical history, and his laboratory results were unremarkable. Gastroscopy was performed, and a flat elevated lesion with focal erythematous changes was observed in the anterior wall of the antrum (Fig. 1). Biopsy showed atypical lymphocytes.

Endoscopic submucosal dissection was performed for the diagnosis and treatment by using an insulation-tipped knife (KD-610L; Olympus Tokyo, Japan) (Fig. 2). The resected specimen showed infiltration of plasma cells into the lamina propria; however, these cells did not extend deeply into the submucosal layer (Fig. 3). Stem Cells inhibitor Radiological and hematological evaluations, including bone marrow biopsy, were performed that showed no involvement of other organs. Finally, the patient was diagnosed with extramedullary

gastric plasmacytoma. Results: extramedullary plasmacytoma is a systemic disease, and hence, the patient was treated with oral thalidomide and dexamethasone. Follow-up gastroendoscopy was performed 6 months later, and the patient’s condition was found to

be stable. Conclusion: Gastric plasmacytoma is classified into nodular, infiltrative, ulcerative, and polypoid types, with the nodular type being the most common. Most gastric plasmacytomas are large and deeply infiltrating tumors with ulceration; however, in the early stage, tumor cells are limited to the mucosal and submucosal layers. Almost all patients with EMP undergo radiation therapy, surgery, or combination therapy (surgery and/or chemotherapy or irradiation). Key Word(s): 1. plasmacytoma; 2. ESD; 3. oral thalidomide; 4. H.pylori.; Presenting Author: YOUN HEE CHO Additional Authors: PIK3C2G SU JIN HONG, DAE YONG KIM, GYU SEOK CHO, GUI AE JEONG, HEE KYUNG KIM, JAE PIL HAN, MIN JIN KIM, BONG MIN KO, MOON SUNG LEE Corresponding Author: SU JIN HONG Affiliations: Soonchunhyang University College of Medicine Objective: The aim of this study was to compare the outcomes of ESD and gastrectomy according to the two indications for ESD (guideline criteria and expanded criteria). Methods: Between January 2004 and July 2007, 230 EGCs of 213 patients was enrolled in this study. Fifty-five patients were included in the guideline criteria (GC) group and 158 in the expanded criteria (EC) group. In the GC group, 35 patients underwent ESD, while 20 underwent gastrectomy. In the EC group, 107 patients underwent ESD, while 51 underwent gastrectomy.

580 for CC versus TT). There was no statistically significant difference in overall graft survival according

to recipient IL28B polymorphism (overall 5-year graft survival [n = 118]: 91% versus 76% versus 84% for CC versus CT versus Nutlin 3a TT genotypes [P = 0.2168]). There was also no significant effect of donor IL28B genotype on overall graft survival (5-year graft survival [n = 124]: 79% versus 84% versus 81% for CC versus CT versus TT genotype [P = 0.6977]). Neither recipient nor donor liver IL28B genotype was found to be significantly associated with liver-related mortality at 5 years (P = 0.3956 and P = 0.2418, respectively) (Fig. 2). An analysis was also performed of the association of IL28B genotype with Proteases inhibitor the frequency of a composite endpoint consisting

of: histological evidence of cirrhosis, liver-related death/retransplantation and fibrosis stage ≥2. The analysis was censored for antiviral therapy. This clinical composite endpoint was significantly associated with recipient and donor, IL28B genotype (P = 0.047 and 0.040 for recipient and donor CC versus TT genotypes, respectively) (Fig. 3). This study reports the association between IL28B genotype and virological treatment response and clinical outcome in HCV-infected patients following OLT. This unique cohort allowed interrogation of the respective roles of the IL28B genotype of hepatocytes (donor) and nonparenchymal cells of extrahepatic origin (recipient). We identified important roles for both donor and recipient IL28B genotype in determining treatment outcome. The data also suggest that recipient Dimethyl sulfoxide IL28B genotype may determine the severity of histological recurrence of hepatitis C as indicated by progressive fibrosis. These findings have potentially important implications for the management of HCV following liver transplantation. The frequency of the CC variant in the transplant recipients was significantly lower than that in the non–HCV-infected donor livers. This is consistent with a role for the CC variant in spontaneous clearance of HCV, with enrichment for the non-CC variants in the chronic

hepatitis C population. Indeed, a role for the CC variant in promoting natural clearance has recently been established.6, 7 Patients with the non-CC genotypes are also more likely to be prior nonresponders to IFN-based therapies before proceeding to liver failure and transplantation. IL28B polymorphism, previously associated with treatment response in the nontransplant setting,4, 5, 7, 9, 10 strongly predicted for increased rate of SVR in the current cohort. Recipient and donor IL28B genotype were both independently associated with higher rates of SVR. Compared to the patients with matched recipient:donor non-CC variants, SVR rate was higher in patients with either a donor or recipient CC variant, and highest in patients with matched donor and recipient CC variants.

34, 35 In 2006, the CDC discontinued its 25-year long surveillance system for acute HCV owing to low numbers of new symptomatic cases and a lack of resources to expand Midostaurin solubility dmso community-based testing sites.3 However, we have demonstrated that a real-life intervention targeted within correctional settings is feasible and has great potential for case identification among PWID, including asymptomatic individuals.36, 37 This streamlined questionnaire meets the mandate

to seek and find HCV within difficult-to-reach populations, voiced by the CDC and the Institute of Medicine.6, 10 Furthermore, although some studies suggest that the incidence of cases had declined through 2006,36 it has been difficult to fully capture trends among PWID due to their fragmented care. Moreover, new epidemics of HCV reported in young Caucasian drug initiates21, 29 likely render

the CDC’s estimate of acute infections as conservative. A jail or prison-based surveillance system may help to elucidate the true burden of new infections among PWID.3, 22 Our questionnaire enhanced the case-finding rate compared with a historical control period11 including the identification of asymptomatic patients, who are less likely to spontaneously Tamoxifen purchase clear viremia.38 Identification of such individuals is particularly important, since early treatment leads to high rates of sustained virologic clearance39 and may decrease the risk of transmission to others upon release to the community. We and others have previously demonstrated that antiviral treatment for acute HCV infection is feasible and as successful in the correctional setting as it is in the community.17, 40 Although treatment efficacy rates for chronic HCV genotype 1 infection are now

improved with the addition of specifically targeted antiviral agents,41 these Oxymatrine are at increased cost and toxicity compared with therapeutic interventions for acute infection.39 In addition to therapy, the structured environment of the prison system offers numerous opportunities for mental health assessments, HIV testing, and counseling regarding prevention, HAV and HBV immunizations, and harm reduction programs to decrease risk of reinfection.6, 30, 42 These interventions were well-received, with over 90% acceptance (data not shown). The age distribution of patients with self-reported HCV infection in our prison population is distinct from that seen in the 1998-2008 NHANES survey.20 Persons born from 1945 to 1965 accounted for over three-fourths of all HCV-infected patients living in the United States; males were twice as likely to be infected as females, and African Americans exhibited the highest seroprevalence rates.20 In stark contrast, 68% of inmates with self-reported HCV infection were born outside this time period.

Regarding specific sleep hygiene behaviors, over half of the entire sample endorsed frequently or always using their bed for something other than sleep or sex (62.0%), doing

something that may wake them up before bedtime this website (61.3%), going to bed at different times each day (56.8%), doing important work before bed (56.5%), and thinking, planning, or worrying in bed (55.8%). However, the MANOVA failed to reveal any significant between-group differences across the 13 specific sleep behaviors, Wilks’ lambda = 0.949, F(13,269) = 1.116, P = not significant. As shown in Table 1, migraineurs reported higher levels of both depression and anxiety than controls. These mean differences were replicated in comparisons click here of group proportions meeting clinical cut-offs for moderate or greater symptomatology on both the PHQ-9 and GAD-7 (scores ≥10). Specifically, 39.7% of migraineurs vs 20.2% of controls reported clinically significant depression (P = .001), and 34.6% of migraineurs vs 18.4% of controls reported clinically significant anxiety (P = .004). As such, depression and anxiety scores were entered as covariates in the subsequent regression analyses. As depicted in Table 2, sleep quality, depression symptomatology, and anxiety symptomatology were all significantly predictive of migraine frequency in the

univariate analyses. Daytime sleepiness and sleep hygiene were not predictive of headache frequency and were thus not analyzed in the adjusted analyses with covariates. After first adjusting for depression and anxiety, the association between sleep quality

and migraine frequency remained significant (Block 2 ΔR2 = 5.3%, P = .04). None of the sleep disturbance or psychiatric GPX6 variables were significantly associated with headache severity. As shown in Table 3, both sleep quality and sleep hygiene were associated with headache-related disability, as were symptoms of depression and anxiety. In the adjusted analyses, depression and anxiety were first entered as covariates, and a stepwise entry procedure was employed with sleep quality and sleep hygiene in the second block (P < .05 required for entry into the model) in order to assess their relative contributions to disability. The stepwise procedure selected only sleep quality into the covariate-adjusted model, which accounted for 5.8% of unique variance in headache-related disability after controlling for depression and anxiety (P = .02). The current study examined the relative importance of 3 distinct sleep disturbance variables (ie, sleep quality, daytime sleepiness, sleep hygiene) pertinent to insomnia among young adult episodic migraineurs, a population of interest because of their high rates of migraine,[40, 41] disturbed sleep,[42, 43] and psychiatric comorbidities.[41, 44] Of additional interest was delineating any potential relationship between sleep disturbance and affective symptomatology.

Patients lost to follow up (LTFU), expired during

the treatment (EX) and in whom HCV RNA by PCR was not checked (NoPCR) at any stage were excluded from the analysis. Results: Total seventy two patients were enrolled. Group A, B, C and D consisted of 13, 29, 11 and 19 patients, respectively. Seventeen patients were excluded from “per protocol treatment” analysis; 2 from group A (2- LTFU), 7 from group B (1 EX, 2-LTFU, 4-NoPCR), 3 from group C (3-NoPCR) and 5 from Group D (1-EX, 1-LTFU, 3-NoPCR). The final analysis was done in 55 patients. In group A, 11 out of 11 patients achieved ETR with a response rate (RR) of 100% while in group B, 11 out of 22 achieved ETR with a RR of 50%. In group C, 6 out of 8 achieved ETR with a RR of 75% while in group D, 3 out of 14 achieved ETR with a RR of 21.4%. For genotype 3 (Group A and B) URVR was significantly predictive of achieving

ETR (Corrected Yates chi square p value = 0.013). Similarly Neratinib chemical structure for genotype 1 (Group C and D) URVR was significantly predictive of achieving ETR (Corrected Yates Chi square p value =0.045). Conclusion: The URVR appears to be a good predictor of favorable treatment outcome for acute hepatitis C infection in patients on MH, especially in G3. Disclosures: The following people have nothing to disclose: Syed M. Hassan, Arzoo Saeed, Muhammad Osama Butt, Nasir Hassan Luck, Syed Mudassir Laeeq, Zaigham Abbas Background: Treatment of chronic hepatitis C (HCV) following liver transplantation has historically been challenging, with unsatisfactory Crizotinib datasheet sustained viral response (SVR) rates and poor interferon tolerability. Phase II data from COSMOS demonstrated high SVR rates in the non-transplant setting. Based on these observations, the Jewish Hospital Transplant Center (JHTC) has opted to treat

recurrent genotype 1 HCV in liver transplant recipients with simeprevir (150 mg daily) plus sofos-buvir (400 mg daily) (sim/sof) Methocarbamol with or without weight-based ribavirin (riba) for 12 weeks. The purpose of this study is to examine preliminary efficacy/safety. Methods: This IRB-ap-proved retrospective chart review examined the first 24 liver transplant recipients treated with sim/sof±riba at the JHTC. Baseline host/virus characteristics were analyzed as well as on-treatment viral kinetics, adverse events (AEs), and immu-nosuppressant dose adjustments. Results: 19 subjects were treatment experienced (17 nonresponders and 2 intolerant of interferon-based treatment regimens), while 5 were treatment naïve. 2 subjects had cirrhosis, but none had cholestatic HCV. 16 were genotype 1a (7 Q80K+ and 9 Q80K-) while 8 were genotype 1b. All genotype1a Q80K+ and 2 genotype 1a Q80K- subjects received sim/sof/riba while the others were treated with sim/sof. 19 subjects had initial viral loads >800,000 IU/mL. 19 subjects have reached at least treatment week 4. Of these, 17 had HCV RNA

Treatment for these underlying infections can potentially lead to improvement in these patients. The Helicobacter Eradication Relief of Dyspeptic Symptoms trial (HEROES) reported eradication effects on symptoms and quality of life of H. pylori-positive patients with FD who met the Rome III International

Consensus criteria [14]. A large single-center randomized double-blind, placebo-controlled trial showed that the antibiotic-treated group of primary care patients with FD significantly benefited from eradication compared with the control group (p = .02). These data should be taken into account by investigators who are presently performing cost–utility studies on the economics of H. pylori eradication in primary care patients with FD. Similar results were reported Src inhibitor in a recent Chinese randomized, single-blind, placebo-controlled study [15] of 195 FD patients with H. pylori infection. The patients were divided into two groups: antibiotic case group and placebo control group. Symptoms of FD, such as postprandial fullness, early satiety, nausea, belching, epigastric pain, and epigastric burning, were assessed 3 months after H. pylori eradication. H. pylori eradication was reported effective in the subgroup of FD patients with epigastric pain syndrome. Yet, symptoms such as postprandial fullness, early satiety, nausea, and belching did not differ from those in the placebo group. A

recent Iranian endoscopy study investigated 217 FD patients with H. pylori infection and

histopathologic changes. Severity Talazoparib in vivo of symptoms was assessed by the Leeds Dyspepsia Questionnaire (LDQ) and its relationship to histopathologic changes. H. pylori infection status was also assessed [16]. Severity of dyspepsia symptoms was not higher in H. pylori-infected patients than noninfected patients, but in the presence of H. pylori infection and microscopic gastritis, microscopic duodenitis significantly worsened the LDQ symptom severity score (p < .001). The odds of experiencing severe symptoms in patients with severe microscopic duodenitis were 2.22 times greater than in individuals with very mild, mild, or moderate duodenitis. Gastroesophageal for reflux disease (GERD) is the most common GI diagnosis recorded in outpatient clinics. The association of H. pylori with GERD is still controversial. A cross-sectional study in Taiwan investigated 594 patients with no reflux symptoms; 14.5% of asymptomatic patients had endoscopic findings of erosive esophagitis [17]. The CLO test for H. pylori was performed during endoscopies. H. pylori infection, male gender, and hiatus hernia were significantly associated with asymptomatic erosive esophagitis (AEE). The study demonstrated that AEE is not a rare condition in the asymptomatic population and that H. pylori is associated with the disease. In contrast, in a Korean case–control study of 5616 H. pylori seropositive subjects, H.

Double immunofluorescence combined NCAM and LGR5. NCAM monoclonal antibody (described above) was incubated overnight at 4°C as first antibodies. After washing the sections five times for 5 min, LGR5 monoclonal antibody (described above) was incubated for 2 h at room temperature as the second primary antibody. After washing the sections three times for 5 min, Alexa Fluor* 488 goat antirabbit IgG (A11008; Invitrogen,

Renfrew, UK) and Alexa Fluor* 546 goat antimouse (H + L) IgG (A11030; Invitrogen) as secondary antibodies, at a dilution of 10 µg/mL, were incubated for 1 h at room temperature. Nuclear staining was done with 4′,6′-diamidino-2-phenylindole dihydrochloride (DAPI) (ProLong Gold Antifade Reagent with DAPI; Invitrogen). Confocal images were acquired by IX71 inverted microscopy with a DP70 digital camera system (Olympus, Center Valley, PA, USA). We selected four FFPE specimens with pathological complete response after chemotherapy. Microdissection of FFPE specimens was performed as previously described.12 We separately obtained each specimen from three locations in damaged liver: (i) central necrotic area;

(ii) adjacent normal liver; and (iii) the fibrotic area including DR between the central necrosis and adjacent normal liver. Microdissected specimens were digested with proteinase K in lysis buffer containing Tris-HCl, ethylenediamine tetraacetic acid and sodium dodecylsulfate, as previously published with minor modifications.13 RNA was purified by phenol and chloroform extraction. Isolated RNA was purified using ethanol precipitation. The concentration and quality of RNA was measured Obeticholic Acid price with ultraviolet absorbance at 260 nm and 280 nm (A260/280 ratio). Reverse transcription of fragmented mRNA from FFPE tissues was performed using random hexamer priming, instead of oligo (dT)-based priming. cDNA was synthesized with random

hexamer and Superscript III reverse transcriptase (Invitrogen, Carlsbad, CA, USA) according to the manufacturer’s instructions. Quantitative reverse transcription polymerase chain reaction (RT–PCR) analysis was carried out with SYBR Green PCR Master Mix (Applied Biosystems, Foster City, CA) using the Applied Biosystems 7500 Real-Time PCR System according to the manufacturer’s instructions. Sequences were as follows: KRT7 (CK7) (sense, AGTATGAGGAGATGGCCAAATG; antisense, CCCGGTTCATCTCTGAAATC); NCAM (sense, TGAGTGGAGAGCAGTTGGTG; antisense, TACGTTGTTTCGGGCTTCAG); PROM1 (CD133) (sense, GCTTTGCAATCTCCCTGTTG; antisense, TTGATCCGGGTTCTTACCTG); LGR5 (sense, GATGTTGCTCAGGGTGGACT; antisense, GGGAGCAGCTGACTGATGTT); GAPDH (sense, GGAAGGTGAAGGTCGGAGTC; antisense, AATGAAGGGGTCATTCATGG); and ACTB (β-actin) (sense, HM781-36B order ACAGAGCCTCGCCTTTGC; antisense, GCGGCGATATCATCATCC). Primers for these genes and the internal control (GAPDH and ACTB) were designed with Primer3 software (Biology Workbench ver. 3.2; San Diego Supercomputer Center, University of California, San Diego).

Patients with Crohn’s disease were more likely to be tested but there were no other factors that predicted screening practices in this setting. Inadequate screening could lead to preventable morbidity and mortality from fulminant flares and long term complications. Moreover, antiHBs were not routinely tested, resulting in potentially missed vaccination opportunities. T TRAN,1 D VAN DER POORTEN1

1Storr Liver Unit, Westmead Millennium Institute, University of Sydney, Westmead, New South Wales, Australia Introduction: Coffee caffeine consumption (CCC) has been shown to have a protective effect on fibrosis progression in hepatitis C and is associated with reduced mortality from alcoholic cirrhosis and HCC. Emerging evidence has suggested

CCC protects Small molecule library against severe forms of Nonalcoholic Steatohepatitis (NASH), but data has been conflicting. We aimed to clarify the association between caffeine intake, in particular coffee caffeine, in a well characterized cohort of patients with biopsy proven Nonalcoholic fatty liver disease (NAFLD). Methods: A validated questionnaire was utilized to determine the caffeine consumption of patients with biopsy proven NAFLD based on their daily consumption of coffee, tea, AG-014699 clinical trial and soft drinks. All patients had fasting blood tests and anthropometric measurements taken on the day of liver biopsy. Liver biopsies were scored using Brunt’s criteria and patients were characterized as having either simple

steatosis or NASH. Caffeine consumption was compared to histological scores including Ballooning, Portal Inflammation, Steatosis and Fibrosis and to markers of liver inflammation and metabolic disturbance. Correlations were made using Spearman selleck chemical rank test, while t tests and Chi Square were used to compare categorical variables. Results: 232 patients were included for analysis, 73 with simple steatosis and 159 with NASH. The mean age of the cohort was 57 and 45.7% were females. Average coffee consumption for the cohort was 10.36 cups/wk or 0.623 grams CCC/wk. There was no difference in overall or CCC between patients with steatosis (10.25 cups/wk), mild NASH (9.77 cups/wk) and severe NASH (10.80 cups/wk). Furthermore, in patients with NASH, there was no correlation between overall or CCC and histological liver changes of Fibrosis, Steatosis, Ballooning, Portal Inflammation, Lobular Inflammation, or Mallory’s Hyaline grade. (p > 0.05). There was no correlation between CCC and ALT, BMI or other key metabolic parameters. Conclusion: Caffeine consumption does not appear to have a protective effect in NASH. Larger studies are needed to determine if specific groups may benefit from increased coffee caffeine.